JAPANESE

	owner	editor	visitor	page editor	login user	guest
View	O	O	O	O	O	O
Edit	O	O	X	O	X	X
Download	O	O	X	O	X	X
Comment	O	O	X	O	X	X
Attachment	O	O	X	-	X	X
Submit	Δ	Δ	X	-	X	X

	Page Creator	Page Visitor	Logon User	Guest
View	O	O	O	O
Edit	O	O	O	O
Download	O	O	O	O
Comment	O	O	O	O
Attachment	O	O	O	O

International Rational Genome Design Contest

Sub Menu

Already entered

What is SciNetS Library?

In GenoCon, JavaScript is used for programming. JavaScript@Scines is a library provided by RIKEN SciNetS which enables users to access SciNeS databases using SciNeS ID. The library is a cluster of functions beginning with `SciNetS`. For details of the cluster of functions, refer the following `JavaScript@SciNeS Function Samples. JavaScript sample programs are here. SciNeS databases are also accessible by using Semantic JSON. (For details.)

JavaScript@SciNetS Function Samples

Display a string

In order to display a string by using JavaScript@SciNetS, use function `SciNeS write` as follows:

SciNetS.write("string");

Click to save the scripts

Click to execute the scripts.

Example) Display `enjoy SciNetS!`

/*------- Codes -----------------------*/
function main(){
  SciNetS.write("enjoy SciNeS!");
}
/*---------------------------------------*/

Obtain a name of contents.

Use function `SciNetS.DB.get`already defined in RIKEN SciNeS

SciNetS.DB.get("/sw/name/language/SciNes ID")

In order to specify language, set `ja` for Japanese and `en` for English between name and SciNetS ID.

Example）to obtain gene codes data of Arabidopsis thaliana.

https://database.riken.jp/sw/links/en/cria151s7ria151s64i/

/*------- codes -----------------------*/
function main(){
 var name = SciNetS.DB.get("/sw/name/en/cria151s7ria151s64i");
 SciNetS.write(name);
}
/*---------------------------------------*/

※Output results

Obtain all page names within a folder

Use function `SciNetS.DB.get` defined in JavaScript @SciNeS twice as follows:

Obtain a list of page IDs of a folder specified by SciNetS ID
SciNetS.DB.get("/sw/pages/SciNes ID")
Obtain a name of the contents specified by SciNeS ID
SciNetS.DB.get("/sw/name/language/SciNes ID")

Example）Obtain all names of the genetic code folder of Arabidopsis thaliana.

https://database.riken.jp/sw/links/en/cria151s7i/

/*------- Codes -----------------------*/
function main(){
  var folder_id = "cria151s7i";
  var page_ids = SciNetS.DB.get("/sw/pages/" + folder_id);
  for(i = 0; i < page_ids.length; i++){
    var page_id = page_ids[i];
    var name = SciNetS.DB.get("/sw/name/en/" + page_id);
    SciNetS.write(name + "<br>");
  }
}
/*---------------------------------------*/

※Output results

Obtain contents of the attached files.

Use function `SciNetS.DB.get` defined in JavaScript@SciNeS as follows:

Obtain a list of IDs of files attached to the data specified by SciNetS ID.
SciNetS.DB.get("/sw/files/SciNes ID")
Obtain contents of the file specified by File ID.
SciNetS.DB.get("/sw/fileTextString/File ID")

Example) Obtain contents of the file named contents_UTF8.txt A.thaliana which is registered in genetic code folder.
https://database.riken.jp/sw/data/ja/cria151s7i/

/*------- Codes -----------------------*/
function main(){
  var folder_id = "cria151s7i";
  var file_ids = SciNetS.DB.get("/sw/files/" + folder_id);
  for(var i = 0; i < file_ids.length; i++){
    if(file_ids[i].search(/contents_UTF8.txt/) != -1){
      var contents = SciNetS.DB.get("/sw/fileTextString/" + file_ids[i]);
      var data = contents.split("\n");
      for(var j = 0; j < data.length; j++){
        var list = data[j].split("\t");
        if(list.length < 3 && list[3].length != 3){continue;}
        SciNetS.write(list[3] + "->" + list[17] + "->" + list[24] + "<br>");
      }
    }
  }
}
/*---------------------------------------*/

※Output results

Write a base sequence into a DNA file

Use function `SciNetS.DB.put` as follows:

SciNetS.DB.put("/sw/dna",a string written in the file)

In this case, the file is saved as dna.txt.

Example) write base sequence into a file

/*------- Codes -----------------------*/
function main(){
  var seq = "GGAGATTCGTGATTGGCCAAGCTAAAAATCTCATAGATCTCATCACAA";
  var status = SciNetS.DB.put("/sw/dna",seq);
  SciNetS.write(status + "<br>");
}
/*---------------------------------------*/

※Output results

※When file saving is completed, `200` is displayed.

※Downloading

Obtain a protein sequence published by RIKEN SciNetS

Use function `SciNetS.DB.get` as follows:

SciNetS.DB.get("/sw/protein/SciNes ID");

Example）to obtain protein sequences attached to `Lepr protein`.

https://database.riken.jp/sw/data/en/cria197s5ria197s1i/

/*------- Codes -----------------------*/
function main(){
  var seq = SciNetS.DB.get("/sw/protein/cria197s5ria197s1i");
  SciNetS.write(seq);
}
/*---------------------------------------*/

Output results

Obtain a DNA sequence attached to contents specified by SciNetS IDs.

Use function, `SciNetS.DB.get` as follows:
SciNeS.DB.get("/sw/dna/SciNes ID");

Example）to obtain DNA sequence attatched to IRES

https://database.riken.jp/sw/data/en/cria228s1ria228s1i/

/*------- Codes -----------------------*/
function main(){
  var seq = SciNetS.DB.get("/sw/dna/cria228s1ria228s1i");
  SciNetS.write(seq);
}
/*---------------------------------------*/

URI	http://scinets.org/item/cria196s1ria196s31i
URL (English)	http://biolod.org/JavaScript_SciNeS/cria196s1ria196s31i?lang=en
	http://scinets.org/item/cria196s1ria196s31i?lang=en
URL (Japanese)	http://biolod.org/JavaScript_SciNeS/cria196s1ria196s31i?lang=ja
	http://scinets.org/item/cria196s1ria196s31i?lang=ja
Attribution	http://scinets.org/item/cria196s1i
RDF (English)	http://biolod.org/class/cria196s1i/GenoCon_International_Rational-Genome-Design_Contest
RDF (Japanese)	http://ja.biolod.org/class/cria196s1i/GenoCon_International_Rational-Genome-Design_Contest